Extender PCR: a method for the isolation of sequences regulating gene expression from genomic DNA.

The isolation and characterization of non-coding genomic DNA sequences flanking coding regions is critical for the analysis of gene transcriptional control mechanisms. In this report, we describe a new polymerase chain reaction (PCR)-based method for “walking” into previously uncloned regions of genomic DNA that negates the need for synthesis of double-stranded vectorette linkers (2), blocked oligonucleotide adaptors (3) or genomic DNA library construction and screening. The method relies on both the ligation of a single-stranded oligonucleotide adaptor to restriction enzyme-digested genomic DNA and the blocking of nonspecific replication of the adaptor-complementary strand by incorporation of a dideoxynucleotide. Figure 1A summarizes the Taq DNA polymerase-catalyzed extension from internal genespecific sites that generates the complementary strand of the ligated adaptor sequence, thus producing the primer annealing sites necessary for the amplification of the desired target sequences. Extender PCR can be used to clone both upstream (5′) and/or downstream (3′) regulatory regions using antisense or sense internal gene-specific primers, respectively. A large molar excess (200:1) of a single-stranded ‘adaptor’ oligonucleotide, 5′-TGCGAGTAAGGATCCTCACGCAAGGAATTCCGACCAGACANNNN-3′, in which NNNN denotes nucleotides complementary to the restriction site used, is annealed to the overhanging ends of genomic DNA fragments that had been produced by single digests with restriction enzymes that leave unique 4-bp 3′ overhanging ends (e.g., PstI, NsiI, AatII or SphI; Figure 1Bi). Annealing restriction digested genomic DNA with adaptor primer is performed in ligation buffer by slow cooling in a thermal cycler, followed by overnight ligation with T4 DNA ligase. Unligated adaptors are then removed by an isopropanol precipitation of the DNA. Using this technique, individual ‘libraries’ for each restriction digest are generated that provide DNA for use in gene-specific PCR amplifications. Restriction enzymes generating 5′ overhanging ends can also be used with this technique (Figure 1A, Bii). Double-stranded genomic DNA digested with any appropriate enzyme (e.g., EcoRI or BamHI) is annealed to an excess of a 1:1 mixture of the adaptor oligonucleotide and a 12-mer that has both a 5′ end complementary to the 4bp 5′ overhang and a 3′ end complementary to the 3′ end of the adaptor sequence (e.g. 5′-AATTTGCATGTC-3′ for EcoRI-digested DNA; see Figure 1Bii). Temporary annealing of the 12mer to the restriction enzyme-generated 5′ overhang produces a complementary site for adaptor sequence annealing (note: this 12-mer is not ligated to the genomic DNA because synthetic oligonucleotides with non-phosphorylated 5′ ends are used). Ligation can then occur between the 3′-hydroxyl group of the adaptor sequence and the 5′-phosphate groups of the genomic DNA. A key feature of this technique is the use of a novel ‘blocking’ procedure to prevent the production of adaptor primer annealing sites at the ends of all genomic DNA fragments during the initial PCR cycle. A dNTP-ddATP mixture is added to the adaptor-ligated genomic DNA in Taq DNA polymerase buffer, and nucleotide incorporation is performed using Taq DNA polymerase until addition of the first ddATP molecule prevents further chain extension (Figure 1Biii). After removal of unincorporated nucleotides, by isopropanol precipitation, the blocked DNA is used as template DNA in PCR using a genespecific primer, usually derived from a cDNA sequence, and the adaptor primer P1 (5′-TGCGAGTAAGGATCCTCACGCA-3′). In the initial cycle of PCR, only 3′-hydroxyl groups of the annealed gene-specific primer are available for extension, ensuring that P1 priming sites are synthesized only at the ends of the DNA fragments of interest. Successive rounds of PCR between the adaptor primer P1 and the genespecific primer amplify the desired sequence. Gene-specific primers of either orientation can be used for the amplification of DNA located 5′ or 3′ to the known sequence. The option of a second PCR using nested gene-specific primers and the adaptor primer P2 (5′CGCAAGGAATTCCGACCAGACA3′), allows further specific amplification of the desired flanking DNA sequences. To demonstrate this principle, 5 μg of genomic DNA from the mantis shrimp Gonodactylus oerstedii was restriction-digested with 10 U of NsiI at 37°C for 12 h, purified and resuspended in 10 μL of ligation buffer. The resuspended DNA was mixed with 740 pmol of the appropriate adaptor primer (containing a 3′ end complementary to the NsiI restriction overhang: 5′TGCA-3′) heated to 55°C for 10 min and cooled to 10°C over 1.5 h. Ligation was performed overnight at 14°C with 40 U T4 DNA ligase (Igi Fermentas, Sunderland, UK). The DNA was precipitated with isopropanol, resuspended in TaqSupreme (Igi Fermentas) buffer [50 mM Tris-HCl (pH 9.1), 16 mM (NH4)2SO4, 3.5 mM MgCl2, 150 μg/mL bovine serum albumin (BSA)] containing a dNTP-ddATP mixture (200 μM each of dCTP, dGTP, dTTP and ddATP), 25 U TaqSupreme, and the 3′ ends were blocked (68°C, 5 min) by ddATP incorporation. The blocked, adaptor-ligated template DNA was phenol-extracted, precipitated and the resulting DNA pellet was dissolved in 50 μL TE buffer. Amplification of target sequences was carried out using 0.2 μg of adaptor-ligated template DNA,